Sunday, September 14, 2014

[Legendary] Zaire Ebola Virus Complete Genome

>gi|10313991|ref|NC_002549.1| Zaire ebolavirus isolate Ebola virus 
H.sapiens-tc/COD/1976/Yambuku-Mayinga, complete genome

CGGACACACAAAAAGAAAGAAGAATTTTTAGGATCTTTTGTGTGCGAATAACTATGAGGAAGATTAATAA
TTTTCCTCTCATTGAAATTTATATCGGAATTTAAATTGAAATTGTTACTGTAATCACACCTGGTTTGTTT
CAGAGCCACATCACAAAGATAGAGAACAACCTAGGTCTCCGAAGGGAGCAAGGGCATCAGTGTGCTCAGT
TGAAAATCCCTTGTCAACACCTAGGTCTTATCACATCACAAGTTCCACCTCAGACTCTGCAGGGTGATCC
AACAACCTTAATAGAAACATTATTGTTAAAGGACAGCATTAGTTCACAGTCAAACAAGCAAGATTGAGAA
TTAACCTTGGTTTTGAACTTGAACACTTAGGGGATTGAAGATTCAACAACCCTAAAGCTTGGGGTAAAAC
ATTGGAAATAGTTAAAAGACAAATTGCTCGGAATCACAAAATTCCGAGTATGGATTCTCGTCCTCAGAAA
ATCTGGATGGCGCCGAGTCTCACTGAATCTGACATGGATTACCACAAGATCTTGACAGCAGGTCTGTCCG
TTCAACAGGGGATTGTTCGGCAAAGAGTCATCCCAGTGTATCAAGTAAACAATCTTGAAGAAATTTGCCA
ACTTATCATACAGGCCTTTGAAGCAGGTGTTGATTTTCAAGAGAGTGCGGACAGTTTCCTTCTCATGCTT
TGTCTTCATCATGCGTACCAGGGAGATTACAAACTTTTCTTGGAAAGTGGCGCAGTCAAGTATTTGGAAG
GGCACGGGTTCCGTTTTGAAGTCAAGAAGCGTGATGGAGTGAAGCGCCTTGAGGAATTGCTGCCAGCAGT
ATCTAGTGGAAAAAACATTAAGAGAACACTTGCTGCCATGCCGGAAGAGGAGACAACTGAAGCTAATGCC
GGTCAGTTTCTCTCCTTTGCAAGTCTATTCCTTCCGAAATTGGTAGTAGGAGAAAAGGCTTGCCTTGAGA
AGGTTCAAAGGCAAATTCAAGTACATGCAGAGCAAGGACTGATACAATATCCAACAGCTTGGCAATCAGT
AGGACACATGATGGTGATTTTCCGTTTGATGCGAACAAATTTTCTGATCAAATTTCTCCTAATACACCAA
GGGATGCACATGGTTGCCGGGCATGATGCCAACGATGCTGTGATTTCAAATTCAGTGGCTCAAGCTCGTT
TTTCAGGCTTATTGATTGTCAAAACAGTACTTGATCATATCCTACAAAAGACAGAACGAGGAGTTCGTCT
CCATCCTCTTGCAAGGACCGCCAAGGTAAAAAATGAGGTGAACTCCTTTAAGGCTGCACTCAGCTCCCTG
GCCAAGCATGGAGAGTATGCTCCTTTCGCCCGACTTTTGAACCTTTCTGGAGTAAATAATCTTGAGCATG
GTCTTTTCCCTCAACTATCGGCAATTGCACTCGGAGTCGCCACAGCACACGGGAGTACCCTCGCAGGAGT
AAATGTTGGAGAACAGTATCAACAACTCAGAGAGGCTGCCACTGAGGCTGAGAAGCAACTCCAACAATAT
GCAGAGTCTCGCGAACTTGACCATCTTGGACTTGATGATCAGGAAAAGAAAATTCTTATGAACTTCCATC
AGAAAAAGAACGAAATCAGCTTCCAGCAAACAAACGCTATGGTAACTCTAAGAAAAGAGCGCCTGGCCAA
GCTGACAGAAGCTATCACTGCTGCGTCACTGCCCAAAACAAGTGGACATTACGATGATGATGACGACATT
CCCTTTCCAGGACCCATCAATGATGACGACAATCCTGGCCATCAAGATGATGATCCGACTGACTCACAGG
ATACGACCATTCCCGATGTGGTGGTTGATCCCGATGATGGAAGCTACGGCGAATACCAGAGTTACTCGGA
AAACGGCATGAATGCACCAGATGACTTGGTCCTATTCGATCTAGACGAGGACGACGAGGACACTAAGCCA
GTGCCTAATAGATCGACCAAGGGTGGACAACAGAAGAACAGTCAAAAGGGCCAGCATATAGAGGGCAGAC
AGACACAATCCAGGCCAATTCAAAATGTCCCAGGCCCTCACAGAACAATCCACCACGCCAGTGCGCCACT
CACGGACAATGACAGAAGAAATGAACCCTCCGGCTCAACCAGCCCTCGCATGCTGACACCAATTAACGAA
GAGGCAGACCCACTGGACGATGCCGACGACGAGACGTCTAGCCTTCCGCCCTTGGAGTCAGATGATGAAG
AGCAGGACAGGGACGGAACTTCCAACCGCACACCCACTGTCGCCCCACCGGCTCCCGTATACAGAGATCA
CTCTGAAAAGAAAGAACTCCCGCAAGACGAGCAACAAGATCAGGACCACACTCAAGAGGCCAGGAACCAG
GACAGTGACAACACCCAGTCAGAACACTCTTTTGAGGAGATGTATCGCCACATTCTAAGATCACAGGGGC
CATTTGATGCTGTTTTGTATTATCATATGATGAAGGATGAGCCTGTAGTTTTCAGTACCAGTGATGGCAA
AGAGTACACGTATCCAGACTCCCTTGAAGAGGAATATCCACCATGGCTCACTGAAAAAGAGGCTATGAAT
GAAGAGAATAGATTTGTTACATTGGATGGTCAACAATTTTATTGGCCGGTGATGAATCACAAGAATAAAT
TCATGGCAATCCTGCAACATCATCAGTGAATGAGCATGGAACAATGGGATGATTCAACCGACAAATAGCT
AACATTAAGTAGTCAAGGAACGAAAACAGGAAGAATTTTTGATGTCTAAGGTGTGAATTATTATCACAAT
AAAAGTGATTCTTATTTTTGAATTTAAAGCTAGCTTATTATTACTAGCCGTTTTTCAAAGTTCAATTTGA
GTCTTAATGCAAATAGGCGTTAAGCCACAGTTATAGCCATAATTGTAACTCAATATTCTAACTAGCGATT
TATCTAAATTAAATTACATTATGCTTTTATAACTTACCTACTAGCCTGCCCAACATTTACACGATCGTTT
TATAATTAAGAAAAAACTAATGATGAAGATTAAAACCTTCATCATCCTTACGTCAATTGAATTCTCTAGC
ACTCGAAGCTTATTGTCTTCAATGTAAAAGAAAAGCTGGTCTAACAAGATGACAACTAGAACAAAGGGCA
GGGGCCATACTGCGGCCACGACTCAAAACGACAGAATGCCAGGCCCTGAGCTTTCGGGCTGGATCTCTGA
GCAGCTAATGACCGGAAGAATTCCTGTAAGCGACATCTTCTGTGATATTGAGAACAATCCAGGATTATGC
TACGCATCCCAAATGCAACAAACGAAGCCAAACCCGAAGACGCGCAACAGTCAAACCCAAACGGACCCAA
TTTGCAATCATAGTTTTGAGGAGGTAGTACAAACATTGGCTTCATTGGCTACTGTTGTGCAACAACAAAC
CATCGCATCAGAATCATTAGAACAACGCATTACGAGTCTTGAGAATGGTCTAAAGCCAGTTTATGATATG
GCAAAAACAATCTCCTCATTGAACAGGGTTTGTGCTGAGATGGTTGCAAAATATGATCTTCTGGTGATGA
CAACCGGTCGGGCAACAGCAACCGCTGCGGCAACTGAGGCTTATTGGGCCGAACATGGTCAACCACCACC
TGGACCATCACTTTATGAAGAAAGTGCGATTCGGGGTAAGATTGAATCTAGAGATGAGACCGTCCCTCAA
AGTGTTAGGGAGGCATTCAACAATCTAAACAGTACCACTTCACTAACTGAGGAAAATTTTGGGAAACCTG
ACATTTCGGCAAAGGATTTGAGAAACATTATGTATGATCACTTGCCTGGTTTTGGAACTGCTTTCCACCA
ATTAGTACAAGTGATTTGTAAATTGGGAAAAGATAGCAACTCATTGGACATCATTCATGCTGAGTTCCAG
GCCAGCCTGGCTGAAGGAGACTCTCCTCAATGTGCCCTAATTCAAATTACAAAAAGAGTTCCAATCTTCC
AAGATGCTGCTCCACCTGTCATCCACATCCGCTCTCGAGGTGACATTCCCCGAGCTTGCCAGAAAAGCTT
GCGTCCAGTCCCACCATCGCCCAAGATTGATCGAGGTTGGGTATGTGTTTTTCAGCTTCAAGATGGTAAA
ACACTTGGACTCAAAATTTGAGCCAATCTCCCTTCCCTCCGAAAGAGGCGAATAATAGCAGAGGCTTCAA
CTGCTGAACTATAGGGTACGTTACATTAATGATACACTTGTGAGTATCAGCCCTGGATAATATAAGTCAA
TTAAACGACCAAGATAAAATTGTTCATATCTCGCTAGCAGCTTAAAATATAAATGTAATAGGAGCTATAT
CTCTGACAGTATTATAATCAATTGTTATTAAGTAACCCAAACCAAAAGTGATGAAGATTAAGAAAAACCT
ACCTCGGCTGAGAGAGTGTTTTTTCATTAACCTTCATCTTGTAAACGTTGAGCAAAATTGTTAAAAATAT
GAGGCGGGTTATATTGCCTACTGCTCCTCCTGAATATATGGAGGCCATATACCCTGTCAGGTCAAATTCA
ACAATTGCTAGAGGTGGCAACAGCAATACAGGCTTCCTGACACCGGAGTCAGTCAATGGGGACACTCCAT
CGAATCCACTCAGGCCAATTGCCGATGACACCATCGACCATGCCAGCCACACACCAGGCAGTGTGTCATC
AGCATTCATCCTTGAAGCTATGGTGAATGTCATATCGGGCCCCAAAGTGCTAATGAAGCAAATTCCAATT
TGGCTTCCTCTAGGTGTCGCTGATCAAAAGACCTACAGCTTTGACTCAACTACGGCCGCCATCATGCTTG
CTTCATACACTATCACCCATTTCGGCAAGGCAACCAATCCACTTGTCAGAGTCAATCGGCTGGGTCCTGG
AATCCCGGATCATCCCCTCAGGCTCCTGCGAATTGGAAACCAGGCTTTCCTCCAGGAGTTCGTTCTTCCG
CCAGTCCAACTACCCCAGTATTTCACCTTTGATTTGACAGCACTCAAACTGATCACCCAACCACTGCCTG
CTGCAACATGGACCGATGACACTCCAACAGGATCAAATGGAGCGTTGCGTCCAGGAATTTCATTTCATCC
AAAACTTCGCCCCATTCTTTTACCCAACAAAAGTGGGAAGAAGGGGAACAGTGCCGATCTAACATCTCCG
GAGAAAATCCAAGCAATAATGACTTCACTCCAGGACTTTAAGATCGTTCCAATTGATCCAACCAAAAATA
TCATGGGAATCGAAGTGCCAGAAACTCTGGTCCACAAGCTGACCGGTAAGAAGGTGACTTCTAAAAATGG
ACAACCAATCATCCCTGTTCTTTTGCCAAAGTACATTGGGTTGGACCCGGTGGCTCCAGGAGACCTCACC
ATGGTAATCACACAGGATTGTGACACGTGTCATTCTCCTGCAAGTCTTCCAGCTGTGATTGAGAAGTAAT
TGCAATAATTGACTCAGATCCAGTTTTATAGAATCTTCTCAGGGATAGTGATAACATCTATTTAGTAATC
CGTCCATTAGAGGAGACACTTTTAATTGATCAATATACTAAAGGTGCTTTACACCATTGTCTTTTTTCTC
TCCTAAATGTAGAACTTAACAAAAGACTCATAATATACTTGTTTTTAAAGGATTGATTGATGAAAGATCA
TAACTAATAACATTACAAATAATCCTACTATAATCAATACGGTGATTCAAATGTTAATCTTTCTCATTGC
ACATACTTTTTGCCCTTATCCTCAAATTGCCTGCATGCTTACATCTGAGGATAGCCAGTGTGACTTGGAT
TGGAAATGTGGAGAAAAAATCGGGACCCATTTCTAGGTTGTTCACAATCCAAGTACAGACATTGCCCTTC
TAATTAAGAAAAAATCGGCGATGAAGATTAAGCCGACAGTGAGCGTAATCTTCATCTCTCTTAGATTATT
TGTTTTCCAGAGTAGGGGTCGTCAGGTCCTTTTCAATCGTGTAACCAAAATAAACTCCACTAGAAGGATA
TTGTGGGGCAACAACACAATGGGCGTTACAGGAATATTGCAGTTACCTCGTGATCGATTCAAGAGGACAT
CATTCTTTCTTTGGGTAATTATCCTTTTCCAAAGAACATTTTCCATCCCACTTGGAGTCATCCACAATAG
CACATTACAGGTTAGTGATGTCGACAAACTAGTTTGTCGTGACAAACTGTCATCCACAAATCAATTGAGA
TCAGTTGGACTGAATCTCGAAGGGAATGGAGTGGCAACTGACGTGCCATCTGCAACTAAAAGATGGGGCT
TCAGGTCCGGTGTCCCACCAAAGGTGGTCAATTATGAAGCTGGTGAATGGGCTGAAAACTGCTACAATCT
TGAAATCAAAAAACCTGACGGGAGTGAGTGTCTACCAGCAGCGCCAGACGGGATTCGGGGCTTCCCCCGG
TGCCGGTATGTGCACAAAGTATCAGGAACGGGACCGTGTGCCGGAGACTTTGCCTTCCATAAAGAGGGTG
CTTTCTTCCTGTATGATCGACTTGCTTCCACAGTTATCTACCGAGGAACGACTTTCGCTGAAGGTGTCGT
TGCATTTCTGATACTGCCCCAAGCTAAGAAGGACTTCTTCAGCTCACACCCCTTGAGAGAGCCGGTCAAT
GCAACGGAGGACCCGTCTAGTGGCTACTATTCTACCACAATTAGATATCAGGCTACCGGTTTTGGAACCA
ATGAGACAGAGTACTTGTTCGAGGTTGACAATTTGACCTACGTCCAACTTGAATCAAGATTCACACCACA
GTTTCTGCTCCAGCTGAATGAGACAATATATACAAGTGGGAAAAGGAGCAATACCACGGGAAAACTAATT
TGGAAGGTCAACCCCGAAATTGATACAACAATCGGGGAGTGGGCCTTCTGGGAAACTAAAAAAACCTCAC
TAGAAAAATTCGCAGTGAAGAGTTGTCTTTCACAGTTGTATCAAACGGAGCCAAAAACATCAGTGGTCAG
AGTCCGGCGCGAACTTCTTCCGACCCAGGGACCAACACAACAACTGAAGACCACAAAATCATGGCTTCAG
AAAATTCCTCTGCAATGGTTCAAGTGCACAGTCAAGGAAGGGAAGCTGCAGTGTCGCATCTAACAACCCT
TGCCACAATCTCCACGAGTCCCCAATCCCTCACAACCAAACCAGGTCCGGACAACAGCACCCATAATACA
CCCGTGTATAAACTTGACATCTCTGAGGCAACTCAAGTTGAACAACATCACCGCAGAACAGACAACGACA
GCACAGCCTCCGACACTCCCTCTGCCACGACCGCAGCCGGACCCCCAAAAGCAGAGAACACCAACACGAG
CAAGAGCACTGACTTCCTGGACCCCGCCACCACAACAAGTCCCCAAAACCACAGCGAGACCGCTGGCAAC
AACAACACTCATCACCAAGATACCGGAGAAGAGAGTGCCAGCAGCGGGAAGCTAGGCTTAATTACCAATA
CTATTGCTGGAGTCGCAGGACTGATCACAGGCGGGAGAAGAACTCGAAGAGAAGCAATTGTCAATGCTCA
ACCCAAATGCAACCCTAATTTACATTACTGGACTACTCAGGATGAAGGTGCTGCAATCGGACTGGCCTGG
ATACCATATTTCGGGCCAGCAGCCGAGGGAATTTACATAGAGGGGCTAATGCACAATCAAGATGGTTTAA
TCTGTGGGTTGAGACAGCTGGCCAACGAGACGACTCAAGCTCTTCAACTGTTCCTGAGAGCCACAACTGA
GCTACGCACCTTTTCAATCCTCAACCGTAAGGCAATTGATTTCTTGCTGCAGCGATGGGGCGGCACATGC
CACATTCTGGGACCGGACTGCTGTATCGAACCACATGATTGGACCAAGAACATAACAGACAAAATTGATC
AGATTATTCATGATTTTGTTGATAAAACCCTTCCGGACCAGGGGGACAATGACAATTGGTGGACAGGATG
GAGACAATGGATACCGGCAGGTATTGGAGTTACAGGCGTTATAATTGCAGTTATCGCTTTATTCTGTATA
TGCAAATTTGTCTTTTAGTTTTTCTTCAGATTGCTTCATGGAAAAGCTCAGCCTCAAATCAATGAAACCA
GGATTTAATTATATGGATTACTTGAATCTAAGATTACTTGACAAATGATAATATAATACACTGGAGCTTT
AAACATAGCCAATGTGATTCTAACTCCTTTAAACTCACAGTTAATCATAAACAAGGTTTGACATCAATCT
AGTTATCTCTTTGAGAATGATAAACTTGATGAAGATTAAGAAAAAGGTAATCTTTCGATTATCTTTAATC
TTCATCCTTGATTCTACAATCATGACAGTTGTCTTTAGTGACAAGGGAAAGAAGCCTTTTTATTAAGTTG
TAATAATCAGATCTGCGAACCGGTAGAGTTTAGTTGCAACCTAACACACATAAAGCATTGGTCAAAAAGT
CAATAGAAATTTAAACAGTGAGTGGAGACAACTTTTAAATGGAAGCTTCATATGAGAGAGGACGCCCACG
AGCTGCCAGACAGCATTCAAGGGATGGACACGACCACCATGTTCGAGCACGATCATCATCCAGAGAGAAT
TATCGAGGTGAGTACCGTCAATCAAGGAGCGCCTCACAAGTGCGCGTTCCTACTGTATTTCATAAGAAGA
GAGTTGAACCATTAACAGTTCCTCCAGCACCTAAAGACATATGTCCGACCTTGAAAAAAGGATTTTTGTG
TGACAGTAGTTTTTGCAAAAAAGATCACCAGTTGGAGAGTTTAACTGATAGGGAATTACTCCTACTAATC
GCCCGTAAGACTTGTGGATCAGTAGAACAACAATTAAATATAACTGCACCCAAGGACTCGCGCTTAGCAA
ATCCAACGGCTGATGATTTCCAGCAAGAGGAAGGTCCAAAAATTACCTTGTTGACACTGATCAAGACGGC
AGAACACTGGGCGAGACAAGACATCAGAACCATAGAGGATTCAAAATTAAGAGCATTGTTGACTCTATGT
GCTGTGATGACGAGGAAATTCTCAAAATCCCAGCTGAGTCTTTTATGTGAGACACACCTAAGGCGCGAGG
GGCTTGGGCAAGATCAGGCAGAACCCGTTCTCGAAGTATATCAACGATTACACAGTGATAAAGGAGGCAG
TTTTGAAGCTGCACTATGGCAACAATGGGACCGACAATCCCTAATTATGTTTATCACTGCATTCTTGAAT
ATTGCTCTCCAGTTACCGTGTGAAAGTTCTGCTGTCGTTGTTTCAGGGTTAAGAACATTGGTTCCTCAAT
CAGATAATGAGGAAGCTTCAACCAACCCGGGGACATGCTCATGGTCTGATGAGGGTACCCCTTAATAAGG
CTGACTAAAACACTATATAACCTTCTACTTGATCACAATACTCCGTATACCTATCATCATATATTTAATC
AAGACGATATCCTTTAAAACTTATTCAGTACTATAATCACTCTCGTTTCAAATTAATAAGATGTGCATGA
TTGCCCTAATATATGAAGAGGTATGATACAACCCTAACAGTGATCAAAGAAAATCATAATCTCGTATCGC
TCGTAATATAACCTGCCAAGCATACCTCTTGCACAAAGTGATTCTTGTACACAAATAATGTTTTACTCTA
CAGGAGGTAGCAACGATCCATCCCATCAAAAAATAAGTATTTCATGACTTACTAATGATCTCTTAAAATA
TTAAGAAAAACTGACGGAACATAAATTCTTTATGCTTCAAGCTGTGGAGGAGGTGTTTGGTATTGGCTAT
TGTTATATTACAATCAATAACAAGCTTGTAAAAATATTGTTCTTGTTTCAAGAGGTAGATTGTGACCGGA
AATGCTAAACTAATGATGAAGATTAATGCGGAGGTCTGATAAGAATAAACCTTATTATTCAGATTAGGCC
CCAAGAGGCATTCTTCATCTCCTTTTAGCAAAGTACTATTTCAGGGTAGTCCAATTAGTGGCACGTCTTT
TAGCTGTATATCAGTCGCCCCTGAGATACGCCACAAAAGTGTCTCTAAGCTAAATTGGTCTGTACACATC
CCATACATTGTATTAGGGGCAATAATATCTAATTGAACTTAGCCGTTTAAAATTTAGTGCATAAATCTGG
GCTAACACCACCAGGTCAACTCCATTGGCTGAAAAGAAGCTTACCTACAACGAACATCACTTTGAGCGCC
CTCACAATTAAAAAATAGGAACGTCGTTCCAACAATCGAGCGCAAGGTTTCAAGGTTGAACTGAGAGTGT
CTAGACAACAAAATATTGATACTCCAGACACCAAGCAAGACCTGAGAAAAAACCATGGCTAAAGCTACGG
GACGATACAATCTAATATCGCCCAAAAAGGACCTGGAGAAAGGGGTTGTCTTAAGCGACCTCTGTAACTT
CTTAGTTAGCCAAACTATTCAGGGGTGGAAGGTTTATTGGGCTGGTATTGAGTTTGATGTGACTCACAAA
GGAATGGCCCTATTGCATAGACTGAAAACTAATGACTTTGCCCCTGCATGGTCAATGACAAGGAATCTCT
TTCCTCATTTATTTCAAAATCCGAATTCCACAATTGAATCACCGCTGTGGGCATTGAGAGTCATCCTTGC
AGCAGGGATACAGGACCAGCTGATTGACCAGTCTTTGATTGAACCCTTAGCAGGAGCCCTTGGTCTGATC
TCTGATTGGCTGCTAACAACCAACACTAACCATTTCAACATGCGAACACAACGTGTCAAGGAACAATTGA
GCCTAAAAATGCTGTCGTTGATTCGATCCAATATTCTCAAGTTTATTAACAAATTGGATGCTCTACATGT
CGTGAACTACAACGGATTGTTGAGCAGTATTGAAATTGGAACTCAAAATCATACAATCATCATAACTCGA
ACTAACATGGGTTTTCTGGTGGAGCTCCAAGAACCCGACAAATCGGCAATGAACCGCATGAAGCCTGGGC
CGGCGAAATTTTCCCTCCTTCATGAGTCCACACTGAAAGCATTTACACAAGGATCCTCGACACGAATGCA
AAGTTTGATTCTTGAATTTAATAGCTCTCTTGCTATCTAACTAAGGTAGAATACTTCATATTGAGCTAAC
TCATATATGCTGACTCAATAGTTATCTTGACATCTCTGCTTTCATAATCAGATATATAAGCATAATAAAT
AAATACTCATATTTCTTGATAATTTGTTTAACCACAGATAAATCCTCACTGTAAGCCAGCTTCCAAGTTG
ACACCCTTACAAAAACCAGGACTCAGAATCCCTCAAACAAGAGATTCCAAGACAACATCATAGAATTGCT
TTATTATATGAATAAGCATTTTATCACCAGAAATCCTATATACTAAATGGTTAATTGTAACTGAACCCGC
AGGTCACATGTGTTAGGTTTCACAGATTCTATATATTACTAACTCTATACTCGTAATTAACATTAGATAA
GTAGATTAAGAAAAAAGCCTGAGGAAGATTAAGAAAAACTGCTTATTGGGTCTTTCCGTGTTTTAGATGA
AGCAGTTGAAATTCTTCCTCTTGATATTAAATGGCTACACAACATACCCAATACCCAGACGCTAGGTTAT
CATCACCAATTGTATTGGACCAATGTGACCTAGTCACTAGAGCTTGCGGGTTATATTCATCATACTCCCT
TAATCCGCAACTACGCAACTGTAAACTCCCGAAACATATCTACCGTTTGAAATACGATGTAACTGTTACC
AAGTTCTTGAGTGATGTACCAGTGGCGACATTGCCCATAGATTTCATAGTCCCAGTTCTTCTCAAGGCAC
TGTCAGGCAATGGATTCTGTCCTGTTGAGCCGCGGTGCCAACAGTTCTTAGATGAAATCATTAAGTACAC
AATGCAAGATGCTCTCTTCTTGAAATATTATCTCAAAAATGTGGGTGCTCAAGAAGACTGTGTTGATGAA
CACTTTCAAGAGAAAATCTTATCTTCAATTCAGGGCAATGAATTTTTACATCAAATGTTTTTCTGGTATG
ATCTGGCTATTTTAACTCGAAGGGGTAGATTAAATCGAGGAAACTCTAGATCAACATGGTTTGTTCATGA
TGATTTAATAGACATCTTAGGCTATGGGGACTATGTTTTTTGGAAGATCCCAATTTCAATGTTACCACTG
AACACACAAGGAATCCCCCATGCTGCTATGGACTGGTATCAGGCATCAGTATTCAAAGAAGCGGTTCAAG
GGCATACACACATTGTTTCTGTTTCTACTGCCGACGTCTTGATAATGTGCAAAGATTTAATTACATGTCG
ATTCAACACAACTCTAATCTCAAAAATAGCAGAGATTGAGGATCCAGTTTGTTCTGATTATCCCAATTTT
AAGATTGTGTCTATGCTTTACCAGAGCGGAGATTACTTACTCTCCATATTAGGGTCTGATGGGTATAAAA
TTATTAAGTTCCTCGAACCATTGTGCTTGGCCAAAATTCAATTATGCTCAAAGTACACTGAGAGGAAGGG
CCGATTCTTAACACAAATGCATTTAGCTGTAAATCACACCCTAGAAGAAATTACAGAAATGCGTGCACTA
AAGCCTTCACAGGCTCAAAAGATCCGTGAATTCCATAGAACATTGATAAGGCTGGAGATGACGCCACAAC
AACTTTGTGAGCTATTTTCCATTCAAAAACACTGGGGGCATCCTGTGCTACATAGTGAAACAGCAATCCA
AAAAGTTAAAAAACATGCTACGGTGCTAAAAGCATTACGCCCTATAGTGATTTTCGAGACATACTGTGTT
TTTAAATATAGTATTGCCAAACATTATTTTGATAGTCAAGGATCTTGGTACAGTGTTACTTCAGATAGGA
ATCTAACACCGGGTCTTAATTCTTATATCAAAAGAAATCAATTCCCTCCGTTGCCAATGATTAAAGAACT
ACTATGGGAATTTTACCACCTTGACCACCCTCCACTTTTCTCAACCAAAATTATTAGTGACTTAAGTATT
TTTATAAAAGACAGAGCTACCGCAGTAGAAAGGACATGCTGGGATGCAGTATTCGAGCCTAATGTTCTAG
GATATAATCCACCTCACAAATTTAGTACTAAACGTGTACCGGAACAATTTTTAGAGCAAGAAAACTTTTC
TATTGAGAATGTTCTTTCCTACGCACAAAAACTCGAGTATCTACTACCACAATATCGGAACTTTTCTTTC
TCATTGAAAGAGAAAGAGTTGAATGTAGGTAGAACCTTCGGAAAATTGCCTTATCCGACTCGCAATGTTC
AAACACTTTGTGAAGCTCTGTTAGCTGATGGTCTTGCTAAAGCATTTCCTAGCAATATGATGGTAGTTAC
GGAACGTGAGCAAAAAGAAAGCTTATTGCATCAAGCATCATGGCACCACACAAGTGATGATTTTGGTGAA
CATGCCACAGTTAGAGGGAGTAGCTTTGTAACTGATTTAGAGAAATACAATCTTGCATTTAGATATGAGT
TTACAGCACCTTTTATAGAATATTGCAACCGTTGCTATGGTGTTAAGAATGTTTTTAATTGGATGCATTA
TACAATCCCACAGTGTTATATGCATGTCAGTGATTATTATAATCCACCACATAACCTCACACTGGAGAAT
CGAGACAACCCCCCCGAAGGGCCTAGTTCATACAGGGGTCATATGGGAGGGATTGAAGGACTGCAACAAA
AACTCTGGACAAGTATTTCATGTGCTCAAATTTCTTTAGTTGAAATTAAGACTGGTTTTAAGTTACGCTC
AGCTGTGATGGGTGACAATCAGTGCATTACTGTTTTATCAGTCTTCCCCTTAGAGACTGACGCAGACGAG
CAGGAACAGAGCGCCGAAGACAATGCAGCGAGGGTGGCCGCCAGCCTAGCAAAAGTTACAAGTGCCTGTG
GAATCTTTTTAAAACCTGATGAAACATTTGTACATTCAGGTTTTATCTATTTTGGAAAAAAACAATATTT
GAATGGGGTCCAATTGCCTCAGTCCCTTAAAACGGCTACAAGAATGGCACCATTGTCTGATGCAATTTTT
GATGATCTTCAAGGGACCCTGGCTAGTATAGGCACTGCTTTTGAGCGATCCATCTCTGAGACACGACATA
TCTTTCCTTGCAGGATAACCGCAGCTTTCCATACGTTTTTTTCGGTGAGAATCTTGCAATATCATCATCT
CGGGTTCAATAAAGGTTTTGACCTTGGACAGTTAACACTCGGCAAACCTCTGGATTTCGGAACAATATCA
TTGGCACTAGCGGTACCGCAGGTGCTTGGAGGGTTATCCTTCTTGAATCCTGAGAAATGTTTCTACCGGA
ATCTAGGAGATCCAGTTACCTCAGGCTTATTCCAGTTAAAAACTTATCTCCGAATGATTGAGATGGATGA
TTTATTCTTACCTTTAATTGCGAAGAACCCTGGGAACTGCACTGCCATTGACTTTGTGCTAAATCCTAGC
GGATTAAATGTCCCTGGGTCGCAAGACTTAACTTCATTTCTGCGCCAGATTGTACGCAGGACCATCACCC
TAAGTGCGAAAAACAAACTTATTAATACCTTATTTCATGCGTCAGCTGACTTCGAAGACGAAATGGTTTG
TAAATGGCTATTATCATCAACTCCTGTTATGAGTCGTTTTGCGGCCGATATCTTTTCACGCACGCCGAGC
GGGAAGCGATTGCAAATTCTAGGATACCTGGAAGGAACACGCACATTATTAGCCTCTAAGATCATCAACA
ATAATACAGAGACACCGGTTTTGGACAGACTGAGGAAAATAACATTGCAAAGGTGGAGCCTATGGTTTAG
TTATCTTGATCATTGTGATAATATCCTGGCGGAGGCTTTAACCCAAATAACTTGCACAGTTGATTTAGCA
CAGATTCTGAGGGAATATTCATGGGCTCATATTTTAGAGGGAAGACCTCTTATTGGAGCCACACTCCCAT
GTATGATTGAGCAATTCAAAGTGTTTTGGCTGAAACCCTACGAACAATGTCCGCAGTGTTCAAATGCAAA
GCAACCAGGTGGGAAACCATTCGTGTCAGTGGCAGTCAAGAAACATATTGTTAGTGCATGGCCGAACGCA
TCCCGAATAAGCTGGACTATCGGGGATGGAATCCCATACATTGGATCAAGGACAGAAGATAAGATAGGAC
AACCTGCTATTAAACCAAAATGTCCTTCCGCAGCCTTAAGAGAGGCCATTGAATTGGCGTCCCGTTTAAC
ATGGGTAACTCAAGGCAGTTCGAACAGTGACTTGCTAATAAAACCATTTTTGGAAGCACGAGTAAATTTA
AGTGTTCAAGAAATACTTCAAATGACCCCTTCACATTACTCAGGAAATATTGTTCACAGGTACAACGATC
AATACAGTCCTCATTCTTTCATGGCCAATCGTATGAGTAATTCAGCAACGCGATTGATTGTTTCTACAAA
CACTTTAGGTGAGTTTTCAGGAGGTGGCCAGTCTGCACGCGACAGCAATATTATTTTCCAGAATGTTATA
AATTATGCAGTTGCACTGTTCGATATTAAATTTAGAAACACTGAGGCTACAGATATCCAATATAATCGTG
CTCACCTTCATCTAACTAAGTGTTGCACCCGGGAAGTACCAGCTCAGTATTTAACATACACATCTACATT
GGATTTAGATTTAACAAGATACCGAGAAAACGAATTGATTTATGACAGTAATCCTCTAAAAGGAGGACTC
AATTGCAATATCTCATTCGATAATCCATTTTTCCAAGGTAAACGGCTGAACATTATAGAAGATGATCTTA
TTCGACTGCCTCACTTATCTGGATGGGAGCTAGCCAAGACCATCATGCAATCAATTATTTCAGATAGCAA
CAATTCATCTACAGACCCAATTAGCAGTGGAGAAACAAGATCATTCACTACCCATTTCTTAACTTATCCC
AAGATAGGACTTCTGTACAGTTTTGGGGCCTTTGTAAGTTATTATCTTGGCAATACAATTCTTCGGACTA
AGAAATTAACACTTGACAATTTTTTATATTACTTAACTACTCAAATTCATAATCTACCACATCGCTCATT
GCGAATACTTAAGCCAACATTCAAACATGCAAGCGTTATGTCACGGTTAATGAGTATTGATCCTCATTTT
TCTATTTACATAGGCGGTGCTGCAGGTGACAGAGGACTCTCAGATGCGGCCAGGTTATTTTTGAGAACGT
CCATTTCATCTTTTCTTACATTTGTAAAAGAATGGATAATTAATCGCGGAACAATTGTCCCTTTATGGAT
AGTATATCCGCTAGAGGGTCAAAACCCAACACCTGTGAATAATTTTCTCTATCAGATCGTAGAACTGCTG
GTGCATGATTCATCAAGACAACAGGCTTTTAAAACTACCATAAGTGATCATGTACATCCTCACGACAATC
TTGTTTACACATGTAAGAGTACAGCCAGCAATTTCTTCCATGCATCATTGGCGTACTGGAGGAGCAGACA
CAGAAACAGCAACCGAAAATACTTGGCAAGAGACTCTTCAACTGGATCAAGCACAAACAACAGTGATGGT
CATATTGAGAGAAGTCAAGAACAAACCACCAGAGATCCACATGATGGCACTGAACGGAATCTAGTCCTAC
AAATGAGCCATGAAATAAAAAGAACGACAATTCCACAAGAAAACACGCACCAGGGTCCGTCGTTCCAGTC
CTTTCTAAGTGACTCTGCTTGTGGTACAGCAAATCCAAAACTAAATTTCGATCGATCGAGACACAATGTG
AAATTTCAGGATCATAACTCGGCATCCAAGAGGGAAGGTCATCAAATAATCTCACACCGTCTAGTCCTAC
CTTTCTTTACATTATCTCAAGGGACACGCCAATTAACGTCATCCAATGAGTCACAAACCCAAGACGAGAT
ATCAAAGTACTTACGGCAATTGAGATCCGTCATTGATACCACAGTTTATTGTAGATTTACCGGTATAGTC
TCGTCCATGCATTACAAACTTGATGAGGTCCTTTGGGAAATAGAGAGTTTCAAGTCGGCTGTGACGCTAG
CAGAGGGAGAAGGTGCTGGTGCCTTACTATTGATTCAGAAATACCAAGTTAAGACCTTATTTTTCAACAC
GCTAGCTACTGAGTCCAGTATAGAGTCAGAAATAGTATCAGGAATGACTACTCCTAGGATGCTTCTACCT
GTTATGTCAAAATTCCATAATGACCAAATTGAGATTATTCTTAACAACTCAGCAAGCCAAATAACAGACA
TAACAAATCCTACTTGGTTTAAAGACCAAAGAGCAAGGCTACCTAAGCAAGTCGAGGTTATAACCATGGA
TGCAGAGACAACAGAGAATATAAACAGATCGAAATTGTACGAAGCTGTATATAAATTGATCTTACACCAT
ATTGATCCTAGCGTATTGAAAGCAGTGGTCCTTAAAGTCTTTCTAAGTGATACTGAGGGTATGTTATGGC
TAAATGATAATTTAGCCCCGTTTTTTGCCACTGGTTATTTAATTAAGCCAATAACGTCAAGTGCTAGATC
TAGTGAGTGGTATCTTTGTCTGACGAACTTCTTATCAACTACACGTAAGATGCCACACCAAAACCATCTC
AGTTGTAAACAGGTAATACTTACGGCATTGCAACTGCAAATTCAACGAAGCCCATACTGGCTAAGTCATT
TAACTCAGTATGCTGACTGTGAGTTACATTTAAGTTATATCCGCCTTGGTTTTCCATCATTAGAGAAAGT
ACTATACCACAGGTATAACCTCGTCGATTCAAAAAGAGGTCCACTAGTCTCTATCACTCAGCACTTAGCA
CATCTTAGAGCAGAGATTCGAGAATTAACTAATGATTATAATCAACAGCGACAAAGTCGGACTCAAACAT
ATCACTTTATTCGTACTGCAAAAGGACGAATCACAAAACTAGTCAATGATTATTTAAAATTCTTTCTTAT
TGTGCAAGCATTAAAACATAATGGGACATGGCAAGCTGAGTTTAAGAAATTACCAGAGTTGATTAGTGTG
TGCAATAGGTTCTACCATATTAGAGATTGCAATTGTGAAGAACGTTTCTTAGTTCAAACCTTATATTTAC
ATAGAATGCAGGATTCTGAAGTTAAGCTTATCGAAAGGCTGACAGGGCTTCTGAGTTTATTTCCGGATGG
TCTCTACAGGTTTGATTGAATTACCGTGCATAGTATCCTGATACTTGCAAAGGTTGGTTATTAACATACA
GATTATAAAAAACTCATAAATTGCTCTCATACATCATATTGATCTAATCTCAATAAACAACTATTTAAAT
AACGAAAGGAGTCCCTATATTATATACTATATTTAGCCTCTCTCCCTGCGTGATAATCAAAAAATTCACA
ATGCAGCATGTGTGACATATTACTGCCGCAATGAATTTAACGCAACATAATAAACTCTGCACTCTTTATA
ATTAAGCTTTAACGAAAGGTCTGGGCTCATATTGTTATTGATATAATAATGTTGTATCAATATCCTGTCA
GATGGAATAGTGTTTTGGTTGATAACACAACTTCTTAAAACAAAATTGATCTTTAAGATTAAGTTTTTTA
TAATTATCATTACTTTAATTTGTCGTTTTAAAAACGGTGATAGCCTTAATCTTTGTGTAAAATAAGAGAT
TAGGTGTAATAACCTTAACATTTTTGTCTAGTAAGCTACTATTTCATACAGAATGATAAAATTAAAAGAA
AAGGCAGGACTGTAAAATCAGAAATACCTTCTTTACAATATAGCAGACTAGATAATAATCTTCGTGTTAA
TGATAATTAAGACATTGACCACGCTCATCAGAAGGCTCGCCAGAATAAACGTTGCAAAAAGGATTCCTGG
AAAAATGGTCGCACACAAAAATTTAAAAATAAATCTATTTCTTCTTTTTTGTGTGTCCA